Download A Giraffe and A Half by Shel Silverstein PDF

By Shel Silverstein

From Shel Silverstein, the New York Times bestselling author of Where the Sidewalk Ends and The Giving Tree, comes a riotous rhyming photograph booklet a couple of boy and his giraffe!

Featuring rhythmic verse and iconic illustrations, A Giraffe and a Half will go away each reader, old and young, guffawing until eventually the very finish. cherished for over fifty years, this vintage captures Silverstein’s signature humor and style.

If you had a giraffe and he stretched one other part, you'll have a giraffe and a half. yet what occurs in the event you glue a rose to the end of his nostril? Or in case you used a chair to sweep his hair? sign up for this giraffe on a rollicking and ridiculous trip that might allure readers from starting to finish.

Show description

Read or Download A Giraffe and A Half PDF

Best mammals books

Haematology of Australian Mammals

Haematology of Australian Mammals is a precious consultant to accumulating and analysing the blood of Australian mammals for haematological reviews and prognosis and tracking of ailment. It outlines common ideas for choosing websites for blood assortment and for dealing with and analysing samples to accomplish caliber effects.

Computational models of visual processing

The plenoptic functionality and the weather of early imaginative and prescient / Edward H. Adelson and James R. Bergen --
Learning receptor positions / Albert J. Ahumada, Jr. --
A version of aliasing in extrafoveal human imaginative and prescient / Carlo L. M. Tiana . .. [et al. ] --
Models of human rod receptors and the ERG / Donald C. Hood and David G. Birch --
The layout of chromatically opponent receptive fields / Peter Lennie, P. William Haake, and David R. Williams --
Spatial receptive box association in monkey V1 and its dating to the cone mosaic / Michael J. Hawken and Andrew J. Parker --
Neural distinction sensitivity / Andrew B. Watson --
Spatiotemporal receptive fields and course selectivity / Robert Shapely, R. Clay Reid, and Robert Soodak --
Nonlinear version of neural responses in cat visible cortex / David J. Heeger. A template matching version of subthreshold summation / Jacob Nachmias --
Noise within the visible process can be early / Denis G. Pelli --
Pattern discrimination, visible filters, and spatial sampling irregularity / Hugh R. Wilson --
A bilinear version of the illuminant's impression on colour visual appeal / David H. Brainard and Brian A. Wandell --
Shading ambiguity : reflectance and illumination / Michael D'Zmura --
Transparency and the cooperative computation of scene attributes / Daniel Kersten --
Theories for the visible belief of neighborhood pace and coherent movement / Norberto M. Grzywacz and Alan L. Yuille --
Computational modeling of visible texture segregation / James R. Bergen and Michael S. Landy --
Complex channels, early neighborhood nonlinearities, and normalization in texture segregation / Norma Graham. Orthogonal distribution research : a brand new method of the learn of texture belief / Charles Chubb and Michael S. Landy --
Shape from X : psychophysics and computation / Heinrichs H. Bülthoff --
Computational matters in fixing the stereo correspondence challenge / John P. Frisby and Stephen B. Pollard --
Stereo, surfaces, and form / Andrew J. Parker . .. [et al. ].

Extra resources for A Giraffe and A Half

Sample text

Use the following pair of primers to amplify a DNA fragment that contains a FLAG-encoding fragment followed by a cmR gene that is flanked two AscI cut sites. 1. Flag-AscI-Cm: gactacaaagacgatgacgacaagGGCGCGCCagccagtatacactccgcta Sequence in lower case encodes FLAG. The AscI site is in upper case. The italicized sequence in lower case is homologous to cmR. 2. AscI-Cm: GGCGCGCC ctgtggaacacctacatctg The AscI site is in upper case. The italicized sequence in lower case is homologous to cmR. 2. Clone the above PCR product using the TOPO cloning kit from Invitrogen according to manufacturer’s instruction.

We choose to add two adenosines immediately upstream of the BstEII cut site in the reverse primer. This puts the coding sequence in frame and creates Genome Manipulations with Bacterial Recombineering… 21 our desired mutation. The sequence AAGGTCACC when translated in the reverse orientation encodes Gly Asp Leu. Step 2. 3, insert this cmR PCR product into the master clone. Use BstEII enzyme to excise the cmR gene. 7 is limited by the number of suitable restriction enzymes. This limitation is placed not only on the residues that can be mutated, also on the exact amino acid to which a particular residue can be mutated.

4 N NaOH. 7. Put a gel upside down atop of the platform (so as DNA near the bottom of the gel locates near the membrane), place a 3MM filter paper, a stuck of paper towel, flat plate and weight in this order. Multiple Genetic Manipulations in DT40 31 8. Take out a membrane, label the sides and rinse with 2× SSC buffer twice. 9. Sandwich a membrane with clean filter papers and bake at 80 °C for 2 h. 6 Southern Blotting 1. Prepare probe DNA either by PCR or excision from the plasmids and column purification.

Download PDF sample

Rated 4.65 of 5 – based on 12 votes